Proctologie Séquence d’Escherichia coli type ST sous-clone H en tant qu’agent pathogène émergent multirésistant aux médicaments chez les vétérans américains

Séquence d’Escherichia coli type ST sous-clone H en tant qu’agent pathogène émergent multirésistant aux médicaments chez les vétérans américains

Contexte La séquence ST d’Escherichia coli, typiquement FQ-R résistante aux fluoroquinolones et / ou produisant des β-lactamases à spectre étendu, est apparue globalement. Nous avons évalué sa prévalence et ses caractéristiques chez les vétérans américains. Des isolats cliniques E coli dépersonnalisés ont été collectés systématiquement dans les groupes de résistance FQ-sensibles, FQ-R, et BLSE-produisant des VAMC ST et de son sous-clone H ont été détectés par réaction en chaîne de polymérase et comparés avec d’autres E coli pour les traits moléculaires, la source, et les profils de résistance Résultats ST représentaient% / de FQ-R et% / d’isolats producteurs de BLSE, mais seulement% / d’isolats de FQ-S P & lt; Le sous-clone H représentait ≥% des isolats FQ-R et BLSE, mais seulement% des isolats FQ-S, ST P & lt; Par contre-calcul,% d’isolats d’E. Coli VAMC représentés au niveau national ST Dans l’ensemble, ST a varié de manière minimale en termes de prévalence selon le type de spécimen, la source hospitalisée / ambulatoire ou la localisation; était la ST la plus répandue, suivie de loin par ST et ST% chacun; et représentaient ≥% β-lactames,>% triméthoprime-sulfaméthoxazole, multidrogue, ou> ciprofloxacine, gentamicine de résistance totale aux antimicrobiens FQ-R et isolats ST produisant des BLSE avaient des scores de virulence plus élevés que les isolats non ST correspondants. Parmi les vétérans américains, ST, principalement son sous-clone H, représente la plupart des E. coli résistants aux antimicrobiens et est la souche E coli dominante dans l’ensemble. Les contributeurs possibles incluent la résistance multidrogue, le contenu étendu du gène de virulence et la transmission continue. en particulier son sous-clone H, pourrait réduire la morbidité, la mortalité et les coûts liés à l’infection chez les anciens combattants

Les infections à Escherichia coli, ST, résistance aux antimicrobiens, vétérans, bêta-lactamases à spectre étenduVoir le commentaire éditorial de Lautenbach sur les pages -Escherichia coli provoque diverses infections extraintestinales, y compris l’infection urinaire, la bactériémie et la méningite, entraînant une morbidité, mortalité et augmentation des coûts La prise en charge de ces infections est compliquée par la prévalence croissante de la résistance aux agents antimicrobiens préférés tels que le triméthoprime-sulfaméthoxazole TMP-SMZ, les fluoroquinolones FQ et les céphalosporines à spectre étendu. , une nouvelle lignée disséminée de E coli multirésistante [, -] Dans des enquêtes récentes, ST a représenté jusqu’à% -% de la population clinique totale de E. coli dans divers endroits, et jusqu’à% -% de tous -spectrum β-lactamase productrice de BLSE ou FQ-résistante FQ-R E coli [, -] La VA du ministère des Anciens Combattants opère la plus grande Les infections à Escherichia coli, en particulier les infections des voies urinaires, sont assez fréquentes chez les vétérans D’après les associations de ST avec les personnes âgées et les contacts avec les soins , et la forte prévalence de ces caractéristiques chez les vétérans, En conséquence, nous avons évalué la prévalence, la répartition géographique et la contribution à la résistance aux antimicrobiens de E coli ST chez les vétérans américains pendant – dans plusieurs centres médicaux VA de VAMC à travers les États-Unis, et a exploré les associations de ST avec des caractères bactériens source et favorisant le fitness

MATÉRIAUX ET MÉTHODES

Patients et isolats

Au cours des laboratoires de microbiologie clinique des VAMC largement distribués, ils ont soumis chacun des isolats E coli extraintestinaux FQ-R et FQ-sensibles FQ-S indéterminés de, ainsi que pour leur rareté comparative aux isolats E coli producteurs de BLSE provenant de – Pour les isolats FQ-S et FQ-R, les laboratoires ont sauvé des isolats FQ-R consécutifs et, parallèlement, des isolats FQ-S arbitrairement sélectionnés. Les isolats ont été soumis au laboratoire de recherche accompagné de la date approximative de collecte, type d’échantillon, patient d’origine vs patient ambulatoire, Les VAMC ont été dans le District de Columbia et les États américains Californie, Colorado, Floride, Idaho, Indiana, Iowa, Massachusetts, Michigan, Minnesota, Mississippi, Missouri, New York, Ohio , Tennessee, Texas, Utah, Washington et Wisconsin Ils ont été assignés aux principales régions de recensement des États-Unis, à savoir l’Ouest, le Midwest, le Sud et le Nord-Est. sur place Les comités d’examen institutionnel locaux et les comités de surveillance de la recherche ont approuvé le protocole d’étude

Méthodes moléculaires

Les isolats ont été évalués pour le génotype ST par amplification en chaîne par polymérase PCR basée sur la détection de SNP polymorphismes mononucléotidiques SN spécifiques dans gyrB et mdh , avec une confirmation sélective par typage de séquence multilocus MLST http: // mlstuccie / mlst / dbs / Ecoli ST les isolats ont été testés par des amorces allèle-spécifiques pour l’allèle de fimH codant un variant du type adhésine fimbriale correspondant au sous-ensemble principal de résistance FQ dans ST, le sous-clone H Les amorces fimHF- CCGCCAATGGTACCGCTATT et le produit fimHR- CAGCTTTAATCGCCACCCCA bp soumis à PCR comme suit: «à °; cycles de secondes à ° et secondes à °; ‘ à; En outre, chacun des isolats non ST sélectionnés FQ-S et FQ-R a été soumis à la MLST, suivi de la stratification ST de type sous-séquence en utilisant le typage fumC-fimH CH, qui utilise un fragment nucléotidique nt de fimH pour résoudre sous-clones intra-ST Les principaux groupes phylogénétiques de E. coli A, B, B et D ont été déterminés par PCR triplex La présence de gènes de virulence extra-intestinale a été évaluée par PCR multiplex [,,] Le facteur de virulence était le nombre total de les gènes de virulence détectés, ajustés pour la détection multiple de la papille P fimbriae, sfa / foc S et FC fimbriae, et les opérons de capsule de groupe kps Les isolats ont été classifiés comme E. Coli ExPEC pathogènes extraintestinaux si positif pour ≥ ce qui suit: papAH et / ou papC P fimbriae, sfa / focDE, afa / draBC Dr-famille adhésines, iutA aérobactine récepteur, et la synthèse de la capsule du groupe kpsM II XbaI électrophorèse sur gel à champ pulsé analyse PFGE a été utilisé pour attribuer des isolats aux pulsotypes basé sur% de similitude de profil à référence Strains Un dendrogramme PFGE a été déduit dans BioNumerics, version Applied Maths, Austin, Texas selon la méthode de groupe de paire non pondérée basée sur des coefficients de Dice Les profils ont également été comparés avec une grande bibliothèque de référence de profil PFGE privé.

Test de sensibilité

Les résultats de susceptibilité pour les agents antimicrobiens ampicilline, ampicilline / sulbactam, céfazoline, ceftriaxone, ciprofloxacine, imipénème, gentamicine, nitrofurantoïne et TMP-SMZ ont été fournis par les VAMC participants basés sur la microdilution locale du bouillon ou les tests de diffusion du disque. Résultats de sensibilité rapportés, si contradictoires avec le ont été réévalués par diffusion sur disque, en utilisant les méthodes spécifiées par Clinical and Laboratory Standards Institute, les souches de référence ATCC et les critères d’interprétation , et les isolats ont été reclassés en conséquence Les interprétations intermédiaires ont été analysées comme résistantes. qu’un isolat a présenté une résistance La résistance multidrogue a été définie en utilisant des seuils, c’est-à-dire une résistance à des classes de médicaments ≥ ou ≥ comptant séparément les pénicillines et les céphalosporines

Estimations de la population

La prévalence globale de la ST, d’autres groupes clonaux et la résistance aux agents antimicrobiens individuels ou combinés ont été estimées par rétromptage en fonction de la prévalence observée de chaque groupe clonal ou phénotype de résistance parmi les isolats de l’étude FQ-R et FQ-S, respectivement et les tailles relatives des populations FQ-R et FQ-S, selon la prévalence de la résistance à la ciprofloxacine dans E coli déclarée à la médiane des laboratoires participants,%; gamme, %-%; Les contributions de résistance spécifiques au tableau ST ont été calculées de manière similaire pour chaque phénotype de résistance en tant que produit de la prévalence observée du phénotype particulier parmi les isolats FQ-S et FQ-R ST, respectivement; la proportion d’isolats FQ-S et FQ-R qui étaient ST Figure; et les tailles relatives des populations FQ-R et FQ-S déterminées comme ci-dessus. Tableau La prévalence globale de chaque phénotype de résistance parmi ST, H ST et d’autres E classique. coli a été estimée de manière similaire.

Tableau Estimation de la contribution globale de ST à la résistance aux antimicrobiens chez Escherichia coli chez les vétérans américains Résistance phénotypique Prévalence globale de la population,% a Fraction estimée due à STb Ampicilline Ampicilline / sulbactam Céfazoline Ceftriaxone Ciprofloxacine Gentamicine TMP-SMZ Imipénem Nitrofurantoïne Multidrogue résistant aux classes ≥ Multidrug résistant à ≥ classes Ciprofloxacine TMP-SMZ Ciprofloxacine TMP-SMZ ampicilline Résistance Phénotype Prévalence globale de la population,% a Fraction estimée due à STb Ampicilline Ampicilline / sulbactame Céfazoline Ceftriaxone Ciprofloxacine Gentamicine TMP-SMZ Imipénème Nitrofurantoïne Multidrogue résistant aux classes ≥ Multidrug résistant aux classes ≥ Ciprofloxacine TMP -SMZ Ciprofloxacine TMP-SMZ ampicilline Abréviation: TMP-SMZ, triméthoprime-sulfaméthoxazole Sur la base de la valeur médiane pour l’indice cumulatif La prévalence des phénotypes de résistance énumérés parmi les isolats de l’étude FQ-S résistants aux fluoroquinolones et FQ-S sensibles aux fluoroquinolones, respectivement, a été calculée comme étant le résultat de la résistance aux fluoroquinolones FQ dans les E. coli signalés par les laboratoires participants du Veterans Affairs Medical Center. suit: prévalence globale du phénotype dans la population source = prévalence du phénotype parmi les isolats de l’étude FQ-R prévalence du phénotype parmi les isolats de l’étude FQ-Sb Basé sur la prévalence% présumée de la résistance FQ voir ci-dessus, la prévalence observée de ST chez FQ-R et FQ-S isolent la figure, et la prévalence observée des phénotypes de résistance répertoriés parmi les isolats de l’étude FQ-R et FQ-S ST, respectivement.

Tableau Prévalence globale de la résistance aux antimicrobiens parmi les isolats de sous-clones ST et H, comparés à d’autres isolats, parmi les isolats cliniques d’Escherichia coli provenant d’anciens combattants américains Prévalence de la résistancea et du risque Ratiob ST par rapport aux autres H Subclone vs autres Résistance Phénotype Totala% STa% Autresa% Hazard Ratiob H STa% Autresa% Danger Ratiob Ampicilline / sulbactam Cefazolin Ceftriaxone Ciprofloxacine Gentamicine TMP-SMZ Imipénem Nitrofurantoïne Multidrogue résistant aux classes ≥ Multidrug résistant aux classes ≥ Ciprofloxacine TMP-SMZ Ciprofloxacine TMP-SMZ ampicilline Prévalence de Résistancea et Risques Ratiob ST vs Autres H Sous-clone vs Autres Résistance Phénotype Totala% STa% Autresa% Danger Ratiob H STa% Autresa% Danger Ratiob Ampicilline Ampicilline / sulbactam Cefazolin Ceftriaxone Ciprofloxacine Gentamicine TMP-SMZ Imipénem Nitrofurantoïne Multidrogue résistant aux classes ≥ Multidrogue résistant aux classes ≥ Ciprofloxacine TMP-SMZ Ciprofloxacine TMP-SMZ ampicilline Abréviation: TMP-SMZ, triméthoprime-sulfaméthoxazole Prévalence de la résistance globale et dans chaque génotype listé calculé sur la base de la prévalence médiane de la résistance FQ aux fluoroquinolones dans les centres médicaux participants d’Anciens Combattants%, la proportion observée d’isolats FQ-résistants et FQ-sensibles qui représentaient ST ou la sous-clone H ST, et la prévalence observée de chaque phénotype de résistance au sein de ces sous-groupesb La prévalence de la résistance parmi les isolats de ST par rapport à tous les autres isolats, ou parmi les isolats de sous-clones H ST par rapport à tous les autres est olatesView Large

Figure Vue largeDownload slideDistribution par groupe de résistance des principaux groupes phylogénétiques d’Escherichia coli, ST, et le sous-clone fimH parmi les isolats d’E. Coli d’anciens combattants Principaux groupes phylogénétiques: Un rose, B jaune, B bleu et D vert ST, hachures fines; sous-clone fimH, hachures croisées en gras Pour la prévalence de ST et du sous-clone fimH ST dans le groupe sensible aux fluoroquinolones par rapport au groupe des β-lactamases résistant aux fluoroquinolones ou à spectre étendu, P & lt; Abréviations: BLSE, β-lactamase à spectre étendu; FQ-R, résistant aux fluoroquinolones; FQ-S, fluoroquinolone-sensibleFigure View largeTélécharger slideDistribution par groupe de résistance des principaux groupes phylogénétiques d’Escherichia coli, ST, et le sous-clone fimH parmi les isolats d’E. Coli des anciens combattants. Principaux groupes phylogénétiques: Un rose, B jaune, B bleu et D vert ST, hachures fines; sous-clone fimH, hachures croisées en gras Pour la prévalence de ST et du sous-clone fimH ST dans le groupe sensible aux fluoroquinolones par rapport au groupe des β-lactamases résistant aux fluoroquinolones ou à spectre étendu, P & lt; Abréviations: BLSE, β-lactamase à spectre étendu; FQ-R, résistant aux fluoroquinolones; FQ-S, sensible aux fluoroquinolones

Analyses statistiques

Les comparaisons de proportions et de variables continues ont été testées en utilisant le test exact de Fisher et le test U de Mann-Whitney, respectivement à la fois en queue et en queue. Le critère d’importance était P & lt;

RÉSULTATS

Prévalence de ST et du sous-clone H ST

Les isolats de l’étude E coli provenaient de VAMC largement distribués et de groupes de susceptibilité constitués: FQ-S n =, FQ-R n = et BLSE n = Bien que la distribution globale des groupes phylogénétiques A, B, B et D était assez similaire entre les groupes de susceptibilité, avec prédominance constante du groupe B, ST représentaient% des isolats FQ-R et% des isolats BLSE, mais seulement% des isolats FQ-S P & lt; , vs FQ-R ou BLSE; Figure En outre, le sous-clone H ST – une lignée nouvellement apparue, associée à la résistance à la FQ dans ST – représentait% -% des isolats ST dans les groupes FQ-R et BLSE, mais seulement% de ceux dans la FQ-S groupe P & lt; , vs FQ-R ou BLSE; La figure ST était largement distribuée géographiquement et présentait des associations constantes avec la résistance à la FQ et la production de BLSE Supplémentaire parmi les isolats FQ-S, ST a été identifié uniquement aux CAVV et représentait seulement% -% des isolats FQ-S par VAMC. -R isolats, ST a été identifié à tous les VAMC, et représentait% -% des isolats FQ-R par VAMC De même, parmi les isolats de BLSE ST a été rencontré à chaque VAMC qui a fourni ≥ isolats ESBL et représentait% -% des isolats de BLSE Par ailleurs, parmi les isolats de BLSE, sa prévalence était significativement plus faible dans la région du Midwest, en%, que dans les autres régions de recensement, qui avaient Les valeurs de prévalence ST de% -% type de spécimen de table supplémentaire ont été documentées pour% isolats et inclus% urinaire,% sanguin, et divers%:% respiratoire,% blessure, & lt;% chacun pour les autres Patients hospitalisés vs ambulatoires la source a été documentée pour% d’isolats, le% provenant de patients ambulatoires n’a pas varié significativement de prévalence selon l’une ou l’autre variable non montrée

Prévalence des ST

Sur la base de la contribution proportionnelle de ST aux sous-groupes FQ-R et FQ-S, plus les tailles respectives de ces sous-groupes, ST a été estimée pour représenter% de tous les isolats E.coli VAMC à l’échelle nationale MLST à sept locus d’un sous-ensemble aléatoire de chaque FQ Selon les back-calculs de la prévalence de la population totale, par ordre décroissant, les isolats FQ-S non-ST les plus prévalents ont été identifiés dans les isolats non-ST de chaque groupe de résistance. ST, ST, ST, ST, et ST% – prévalence de chacun, alors que les isolats FQ-R les plus prévalents étaient ST, ST, ST et ST% – prévalence de chacun. Par conséquent, ST était de loin la ST la plus prévalente. pourcentage global de prévalence totale, nettement plus élevé que les ST, ST et ST% suivants; Figure Sur la base de calculs similaires, la prévalence globale du sous-clone H ST a été estimée à%, & gt; supérieur à celui des sous-clones CH à base de fimH les plus prévalents, – et – à partir de ST:%

Figure Vue largeDownload Prolongez la prévalence globale de la ST et d’autres types de séquences ST parmi les isolats cliniques d’Escherichia coli provenant d’anciens combattants Les prévalences globales estimées ont été calculées sur la base de sous-échantillons Presque tous les isolats ST résistants aux fluoroquinolones représentent le sous-clone fimH: Abréviations: FQ- R, résistant aux fluoroquinolones; FQ-S, fluoroquinolone-sensibleFigure View largeDownload Prolongez la prévalence globale de la ST et d’autres types de séquences ST parmi les isolats cliniques d’Escherichia coli d’anciens combattants Les prévalences globales estimées ont été calculées sur la base de sous-échantillons Presque tous les isolats ST résistants aux fluoroquinolones représentaient la Sous-clone ST Abréviations: FQ-R, résistant aux fluoroquinolones; FQ-S, sensible aux fluoroquinolones

Analyse PFGE

Analyse par électrophorèse XbaI des isolats ST choisis au hasard La figure montre une prédominance des pulsotypes%,% et%, comme dans un récent sondage mondial sur les isolats ST Les pulsotypes ont été largement répartis entre les VAMC et les régions de recensement. chacun, comprenait des isolats de VAMC largement séparés

Figure View largeTélécharger le dendrogramme basé sur l’électrophorèse sur gel d’électrophorèseXbal pour les isolats de ST Escherichia coli chez les vétérans Les isolats ont été sélectionnés au hasard parmi la population totale de ST Région représente les principales régions de recensement américaines Lignes horizontales liées aux pulsotypes les plus courants Ligne verticale sépare les isolats avec ≥% similitude de profil globale d’isolats moins similaires Abréviations: BLSE, β-lactamase à spectre étendu; FQ, phénotype fluoroquinolone R, résistant; S, sensible; PFGE, électrophorèse en champ pulséFigure View largeTélécharger Diapositive sur gel d’électrophorèse à base de champ pulséXbal pour isolats de ST Escherichia coli provenant d’anciens combattants Les isolats ont été sélectionnés au hasard dans la population ST totale. la ligne sépare les isolats avec ≥% de similarité globale du profil provenant d’isolats moins similaires. Abréviations: BLSE, β-lactamase à spectre étendu; FQ, phénotype fluoroquinolone R, résistant; S, sensible; PFGE, électrophorèse sur gel à champ pulsé

Gènes de virulence

Les caractères de virulence ont été évalués comme pouvant contribuer à la forte prévalence de ST Parmi les gènes de virulence étudiés,% / variait significativement de prévalence avec le génotype ST dans plusieurs groupes de résistance Figure ST-gènes de virulence associés inclus certaines adhésines afa / dra, iha, fimH, toxine sat, récepteurs sidérophores iutA, fyuA, variantes de capsule kpsMT II, ​​K, K, et divers caractères usp, ompT, traT, et malX Les gènes non associés à ST comprenaient d’autres adhésines papAHCEFG, allèles papG I et II, sfa / focDE, toxines hlyA, cnf, hlyF, pic, cuve, astA, récepteurs sidérophores iroN, ireA, capsule de protectins K, lipopolysaccharide O [rfc], et microcines / colibactines clbB, clbN, cvaC

Figure Vue largeTélécharger les génotypes de virulence des isolats d’Escherichia coli par rapport au génotype ST, par groupe de résistance aux antimicrobiens Les caractères indiqués sont ceux parmi les totaux qui ont donné P & lt; pour les comparaisons des barres roses ST et des barres bleues non-ST dans au moins le groupe de résistance Les caractères sont disposés, de haut en bas, par ordre décroissant de prévalence parmi les isolats FQ-S ST sensibles aux fluoroquinolones s’ils sont positivement associés à ST, puis ascendants la prévalence parmi les isolats FQ-S non-ST, s’ils sont négativement associés aux symboles de valeur STP, est montrée adjacente au groupe de prévalence supérieure lorsque P & lt; et sont comme suit: * P & lt; , ** P & lt; , *** P & lt; Les rectangles renferment des traits qui contribuent à la définition moléculaire des définitions de E coli pathogènes extraintestinaux: afa / draBC, adhésines de la famille Dr; clbB et clbN, synthèse de colibactine; cnf, facteur nécrosant cytotoxique; fi mH, tapez fimbriae; fyuA, récepteur de yersiniabactine; hlyA, hémolysine a; hra, agglutinine thermorésistante; Iha, adhésine-sidérophore; ireA, récepteur sidérophore; iroN, récepteur de la salmochéline; iutA, récepteur de l’aérobactine; kpsM II, capsule de groupe; K, K et K, variantes de capsules de groupe; malX, marqueur d’îlot de pathogénicité; ompT, protéase de la membrane externe T; papA, papC, papEF, et papG, sous-unité structurale de P fi mbrial, assemblage, pilins de pointe, et adhésine, respectivement; allèle papG II, variant d’adhésine P; sat, sécrétée autotransporteuse toxine; sfa / foc, S ou FC fibriae; traT, associé à la résistance au sérum; usp, protéine uropathogène spécifique; vat, vacuolating toxin Abréviations: BLSE, β-lactamase à spectre étendu; FQ-R, résistant aux fluoroquinolones; FQ-S, fluoroquinolone-sensibleFigure View largeTélécharger les diapositives Génotypes de virulence des isolats d’Escherichia coli par rapport au génotype ST, par groupe de résistance aux antimicrobiens Les caractères indiqués sont ceux parmi les totaux qui ont donné P & lt; pour les comparaisons des barres roses ST et des barres bleues non-ST dans au moins le groupe de résistance Les caractères sont disposés, de haut en bas, par ordre décroissant de prévalence parmi les isolats FQ-S ST sensibles aux fluoroquinolones s’ils sont positivement associés à ST, puis ascendants la prévalence parmi les isolats FQ-S non-ST, s’ils sont négativement associés aux symboles de valeur STP, est montrée adjacente au groupe de prévalence supérieure lorsque P & lt; et sont comme suit: * P & lt; , ** P & lt; , *** P & lt; Les rectangles renferment des traits qui contribuent à la définition moléculaire des définitions de E coli pathogènes extraintestinaux: afa / draBC, adhésines de la famille Dr; clbB et clbN, synthèse de colibactine; cnf, facteur nécrosant cytotoxique; fi mH, tapez fimbriae; fyuA, récepteur de yersiniabactine; hlyA, hémolysine a; hra, agglutinine thermorésistante; Iha, adhésine-sidérophore; ireA, récepteur sidérophore; iroN, récepteur de la salmochéline; iutA, récepteur de l’aérobactine; kpsM II, capsule de groupe; K, K et K, variantes de capsules de groupe; malX, marqueur d’îlot de pathogénicité; ompT, protéase de la membrane externe T; papA, papC, papEF, et papG, sous-unité structurale de P fi mbrial, assemblage, pilins de pointe, et adhésine, respectivement; allèle papG II, variant d’adhésine P; sat, sécrétée autotransporteuse toxine; sfa / foc, S ou FC fibriae; traT, associé à la résistance au sérum; usp, protéine uropathogène spécifique; vat, vacuolating toxin Abréviations: BLSE, β-lactamase à spectre étendu; FQ-R, résistant aux fluoroquinolones; FQ-S, les profils de virulence sensibles aux fluoroquinolones parmi les isolats ST étaient assez constants dans les groupes de résistance, mais parmi les isolats non ST, ils variaient beaucoup selon le groupe de résistance, étant beaucoup plus épars parmi les isolats FQ-R et BLSE que les isolats FQ-S. une proportion significativement plus élevée de ST que d’isolats non ST qualifiés moléculairement comme ExPEC FQ-S,% vs%: P =; FQ-R,% vs%: P =; BLSE,% vs%: P & lt; Parmi les isolats de FQ-S, les scores FV étaient également élevés indépendamment du génotype ST Figure En revanche, parmi les isolats FQ-R et BLSE, les scores FV étaient beaucoup plus élevés parmi les isolats de ST que les isolats non-ST.

Figure Vue largeTélécharger les scores de virulence et de résistance parmi les isolats ST et Escherichia coli non ST dans les groupes de résistance Les tracés à moustaches montrent les médianes du groupe barre horizontale lourde, percentiles inférieur et supérieur du bas et du haut respectivement et valeurs maximales et minimales lumineuses les valeurs des barres horizontales P, déterminées par le test U de Mann-Whitney, sont indiquées pour les comparaisons ST et non-ST lorsque P & lt; A, la virulence marque le nombre de gènes de virulence distincts parmi les isolats ST vs non ST dans chaque groupe de résistance B, scores de résistance nombre de marqueurs de résistance détectés parmi les isolats ST vs isolats non ST dans chaque groupe de résistance Abréviations: BLSE, spectre β étendu la lactamase; FQ-R, résistant aux fluoroquinolones; FQ-S, fluoroquinolone-sensibleFigure View largeTélécharger les scores de virulence et de résistance parmi les isolats ST et Escherichia coli non ST dans les groupes de résistance Les tracés à moustaches montrent les médianes de groupe, les centiles inférieurs et supérieurs des boîtes, respectivement, et les valeurs maximales et minimales des valeurs horizontales de lumière P, telles que déterminées par le test U de Mann-Whitney, sont indiquées pour les comparaisons ST et non-ST lorsque P & lt; A, la virulence marque le nombre de gènes de virulence distincts parmi les isolats ST vs non ST dans chaque groupe de résistance B, scores de résistance nombre de marqueurs de résistance détectés parmi les isolats ST vs isolats non ST dans chaque groupe de résistance Abréviations: BLSE, spectre β étendu la lactamase; FQ-R, résistant aux fluoroquinolones; FQ-S, sensible aux fluoroquinolones

Résistance antimicrobienne

La résistance aux agents antimicrobiens étudiés, à la fois individuellement et combinés, varie grandement en prévalence par agent et groupe de résistance, mais minimalement par ST génotype Figure Parallèlement à ces tendances, les scores agrégés de résistance augmentent progressivement par groupe de résistance, de FQ-S à FQ-R Dans un groupe de résistance donné, les isolats de ST présentaient des scores de groupe FQ-R et BLSE similaires, ou des scores de groupe FQ-S légèrement mais significativement plus élevés que les isolats non-ST.

Figure View largeDownload Prévalence de la résistance aux antimicrobiens parmi les isolats d’E. Coli selon le statut ST et les symboles de valeur P du groupe de résistance du test U de Mann-Whitney pour la comparaison des barres roses ST et des barres bleues non ST dans chaque groupe de résistance. le groupe de prévalence plus élevé si P & lt; , sont les suivants: * P & lt; , ** P ≤, *** P ≤ Abréviations: AMP, ampicilline; A / S, ampicilline-sulbactame; CIP, ciprofloxacine; CTR, ceftriaxone; CZ, céfazoline; BLSE, ß-lactamase à spectre étendu; FQ-R, résistant aux fluoroquinolones; FQ-S, sensible aux fluoroquinolones; GEN, gentamicine; IMI, imipénème; MDR, multirésistance aux médicaments ≥ ou ≥ classes de médicaments; NIT, nitrofurantoïne; Prévalence de la résistance aux antimicrobiens parmi les isolats d’E. Coli selon le statut ST et les symboles de la valeur P du groupe de résistance du test U de Mann-Whitney pour la comparaison des barres roses ST et des barres bleues non ST dans chaque groupe de résistance. , qui sont indiqués à côté du groupe de prévalence plus élevé si P & lt; , sont les suivants: * P & lt; , ** P ≤, *** P ≤ Abréviations: AMP, ampicilline; A / S, ampicilline-sulbactame; CIP, ciprofloxacine; CTR, ceftriaxone; CZ, céfazoline; BLSE, ß-lactamase à spectre étendu; FQ-R, résistant aux fluoroquinolones; FQ-S, sensible aux fluoroquinolones; GEN, gentamicine; IMI, imipénème; MDR, multirésistance aux médicaments ≥ ou ≥ classes de médicaments; NIT, nitrofurantoïne; T / S, trimethoprim-sulfamethoxazoleBack-calculs a suggéré que la contribution globale de ST à la résistance aux antimicrobiens dans la population E coli source était ≥% pour chaque agent β-lactame, '% pour TMP-SMZ résistance et multirésistance, et & gt;% pour Tableau La prévalence globale estimée de chaque phénotype de résistance était constamment plus élevée parmi les isolats de sous-clones ST et H que parmi les autres isolats ratios de risque médians, – ; gamme, – Les valeurs de prévalence de la résistance stratifiée pour les isolats de sous-clones ST ou H par rapport à d’autres isolats chevauchaient souvent un seuil de prévalence, p. ex.,%,%,% couramment utilisé pour sélectionner un traitement antimicrobien empirique.

DISCUSSION

Le groupe clonal le plus répandu dans les collections de tous les isolats cliniques d’E. coli provenant de régions spécifiques [,,,,,], aucun n’a montré un tel écart entre ST et les groupes clonaux ExPEC à prévalence élevée traditionnelle tels que ST, ST, ST et , la plupart des isolats actuels de ST, y compris presque tous dans les groupes FQ-R et BLSE, représentaient le sous-clone H ST, dont l’origine récemment démontrée était une souche unique et représentait la plupart des isolats FQ-R ST, peu importe Par conséquent, ce sous-clone unique et remarquablement réussi au sein de la ST a dominé la population de E. coli associée au Vétéran, en particulier le sous-ST résistant aux antimicrobiens a été distribué assez uniformément dans les VAMC, les régions géographiques, les types d’échantillons et les patients hospitalisés. L’omniprésence de ST chez les vétérans américains indique que les résultats de l’étude sont probablement applicables dans tout le système de santé VA, et dans des populations non-vétéran La survenue de VAMC de pulsotypes associés à la ST dans la population générale suggère une transmission continue de ST chez les VAMC et entre vétérans et non-vétérans, et que des facteurs de risque et des voies de transmission similaires pour ST peuvent s’appliquer aux populations vétérans et non-vétérinaires. L’émergence et la prédominance de ST comparées à d’autres E coli, les isolats ST plus souvent représentés par le groupe phylogénétique B, avaient des génotypes de virulence plus étendus et / ou des profils de résistance aux antimicrobiens, et plus communément qualifiés moléculairement comme ExPEC Ceci implique que, dans la ST, la résistance aux antimicrobiens combiné avec la virulence extra-intestinale dans une mesure non observée précédemment chez E. coli, créant ainsi une “superbactérie” proverbiale Bien que les preuves in vivo de l’hypervirulence chez les modèles animaux manquent [,,], ces modèles peuvent ne pas refléter la situation humaine. données épidémiologiques documentent un gradient de prévalence de ST par rapport à Enfin, d’après les calculs rétrospectifs, ST représentait la majorité de la résistance aux antimicrobiens parmi les isolats cliniques, en particulier chez certains isolats cliniques, en particulier chez certains isolats de pyélonéphrite. agents individuels FQ,%; TMP-SMZ,%; gentamicine,%, résistance combinée TMP-SMZ plus FQ%, et résistance multidrogue ≥ classes,%; Par conséquent, les infections à E. coli résistantes aux antimicrobiens chez les vétérans sont principalement causées par la ST et, plus particulièrement, par le sous-clone H, ce qui indique que la propagation clonale domine à la fois le transfert horizontal des éléments de résistance et la mutation de novo. Premièrement, compte tenu de la forte prévalence globale de ST et de sa contribution majeure aux infections à E. coli résistantes aux antimicrobiens, une attention particulière à ST pourrait entraîner des réductions substantielles de la morbidité et des coûts au sein du système de santé VA. Elles pourraient inclure des interventions préventives, par exemple, des vaccins ou des probiotiques, des stratégies de lutte contre les infections analogues au dépistage actuel de la colonisation par Staphylococcus aureus résistant à la méthicilline , et la détection rapide, en particulier de la H sous-clone détection rapide pourrait Comme pour de nombreux agents, les isolats de sous-clones ST et H présentaient des valeurs de prévalence de résistance dépassant les seuils de traitement empiriques typiques de%,% ou%, avec d’autres isolats tombant en dessous de ces seuils. L’émergence de nouveaux agents pathogènes résistants et virulents a permis de mieux comprendre l’émergence de nouveaux pathogènes résistants et virulents, permettant ainsi une réponse plus efficace aux futures “superbactéries” épidémiques. Une surveillance continue de ces pathogènes émergents est nécessaire Les limites de l’étude comprennent l’absence de données cliniques, le recours à des résultats de susceptibilité déterminés localement, l’échantillonnage moins systématique des isolats de BLSE que les isolats FQ-S et FQ-R et le grand nombre de comparaisons non ajustées. population d’étude récente et largement répartie, l’échantillonnage systématique de Les isolats FQ-S et FQ-R, et l’attention accordée à de multiples variables écologiques et caractéristiques bactériennes En résumé, nous avons documenté une prévalence impressionnante de ST et de son sous-clone fimH parmi les isolats cliniques d’E. coli provenant des vétérans américains de ST qui représentaient plus de résistance aux antimicrobiens. Les FQ, la TMP-SMZ, la gentamicine et les classes de médicaments multiples ont présenté une virulence induite par des molécules plus importantes que les autres E coli. L’attention focalisée sur ST et son sous-clone H pourrait aider à réduire la morbidité, la mortalité et les coûts de santé.

Remarques

Clause de non-responsabilité Les opinions exprimées sont uniquement celles des auteurs et ne reflètent pas les points de vue et les politiques du Département des Anciens Combattants. Les investigateurs VICTORY Bradley L Allen, MD, PhD Roudebush VAMC et Indiana University School of Medicine, Indianapolis; Gio J Baracco, MD, Miami, VA Healthcare System [HCS] et l’Université de Miami Miller School of Medicine, Miami, FL; Roger Bedimo, MD, MS, FACP VA North Texas HCS et UT Southwestern Medical Center, Dallas; Mary Bessesen, MD Département des Anciens Combattants Eastern Colorado HCS et Université du Colorado-Denver School of Medicine, Denver; Robert A Bonomo, MD Cleveland VAMC, Cleveland, OH; Stephen M Brecher, Ph.D. VA Boston HCS et BU School of Medicine, Boston, MA; Sheldon T. Brown, MD James J. Peters VAMC, Bronx, NY, et Mt Sinaï School of Medicine, NY, NY; Laila Castellino, MD VAMC et Wright State University École de médecine Boonshoft, Dayton, OH; Arundhati S Desai, MD Kansas Ville VAMC, Kansas City, MO; Fletcher Fernau, BA James J. Peters VAMC, Bronx, NY; Mark A Fisher, Ph.D., Département de pathologie de l’Université de l’Utah, et Laboratoires ARUP, Salt Lake City; James Fleckenstein, MD Université de Washington, St Louis, MO; Carol S Fleming, BA, MTASCP, CLS VA NCHCS Sacramento, Mather, CA; Narla J Fries, CEMAT, MTASCP James A Haley VAMC, Tampa, FL; Virginia L Kan, MD, FACP VA Medical Center et George Washington University, Washington, DC; Carol A Kauffman, MD VA Ann Arbor HCS et l’école de médecine de l’Université du Michigan, Ann Arbor; Stacey Klutts, PhD, et Michael Ohl, MD, MSPH Iowa City VAMC et Université de l’Iowa, Iowa City; Thomas Russo, MD Buffalo VAMC et SUNY à Buffalo, NY; Andrea Swiatlo, MS, MTASCP VAMC, Jackson, MS; et Edwin Swiatlo, MD, Ph.D. VAMC et Centre médical de l’Université du Mississippi, Jackson. Remerciements Ce document est basé sur les travaux du Bureau de recherche et de développement, du Service de recherche médicale, du Département des Anciens Combattants et du National Institutes of La subvention de santé numéro RC-AI à EVS et JRJ Dave Prentiss Minneapolis VAMC aidé à préparer les chiffres Mark Bielke, MD Milwaukee VAMC, Milwaukee, WI, Jill E Clarridge III, Ph.D. Puget Sound HCS VAMC et Université de Washington, Seattle, Christopher Graber, MD GLAHS-WLA campus, Los Angeles, CA, Dennis Stevens, MD Boise VAMC, Boise, ID, et Michael Tyndale PVAHCS, San Diego, CA fourni des isolats et des données source associées Conflits d’intérêts potentiels JRJ a des subventions de recherche et / ou des contrats de Merck, Rochester Medical, ICET et Syntiron, et a des demandes de brevet relatives à des tests de diagnostic pour ST et d’autres lignées E coli EVS a des demandes de brevet relatives aux tests de diagnostic pour les lignées ST et autres E coli Tous les autres auteurs ne signalent aucun conflit potentiel Tous les auteurs ont soumis le formulaire ICMJE pour la divulgation des conflits d’intérêts potentiels Conflits que les éditeurs considèrent pertinents pour le contenu du manuscrit ont été divulgués